| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.016060 |
| Chromosome: | chromosome 12 |
| Location: | 4941174 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g524400 | (1 of 1) IPR003128//IPR007122//IPR029919 - Villin headpiece // Villin/Gelsolin // Protein flightless-1 | CDS | |
| Cre12.g524450 | PTP3 | Protein tyrosine phosphatase; (1 of 1) PF00102//PF00782 - Protein-tyrosine phosphatase (Y_phosphatase) // Dual specificity phosphatase, catalytic domain (DSPc) | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCTTGAAAGCATCGCGGTCCATTCCGAACACCTCCTTGAACTCCCCGT |
| Internal bar code: | CCCGCTTGCTTGTGGCTGTCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2082 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCGAAGTTCTCAGTCACC |
| Suggested primer 2: | CTGGCGCAGATATGTTTGCC |