Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.016067 |
Chromosome: | chromosome 10 |
Location: | 537879 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g421250 | EXO70 | (1 of 1) K07195 - exocyst complex component 7 (EXOC7, EXO70); Component of the Exocyst Complex | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCAACACACACGACCGTGTCCGCGACCCAGCGCGCACACACATTAGTG |
Internal bar code: | TCACTGATTTGATGGCAGTCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 103 |
LEAP-Seq percent confirming: | 2.32558 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 42 |
LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGGTACGGTATATGCGCAA |
Suggested primer 2: | CAAGTTCGACTGGACGGTGA |