Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.016155 |
Chromosome: | chromosome 9 |
Location: | 4603279 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g401552 | (1 of 2) IPR000104//IPR002893//IPR003072 - Antifreeze protein, type I // Zinc finger, MYND-type // Orphan nuclear receptor, NOR1 type | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATGATCTCTTACAAATTCAAGCCTATGCATGCAACATAGTATTGGCTGG |
Internal bar code: | TATCTCTGTCTTGGTAAAGAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3054 |
LEAP-Seq percent confirming: | 86.6667 |
LEAP-Seq n confirming: | 13 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGAGTTCTGCAAAAGCGTGC |
Suggested primer 2: | AAATTCCTGGGCTGGTCGAG |