Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.016161 |
Chromosome: | chromosome 1 |
Location: | 5450163 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g038500 | CYP746A1,CYP3 | Cytochrome P450, CYP197 superfamily, CYP197B family; (1 of 3) IPR001128//IPR002397//IPR002401//IPR002403 - Cytochrome P450 // Cytochrome P450, B-class // Cytochrome P450, E-class, group I // Cytochrome P450, E-class, group IV | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGTCCCATGTGGGCAACCACTCGGGGATGACGAAGCCGGTGGCGGCGC |
Internal bar code: | GTTGGGACGTACACGACGGTTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1131 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 22 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCACCCAACCCCCTACTGAT |
Suggested primer 2: | CTTCGTAACCCCGCTATCCC |