Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.016240 |
Chromosome: | chromosome 9 |
Location: | 867435 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g403500 | (1 of 1) PF12796//PF13637//PF13920 - Ankyrin repeats (3 copies) (Ank_2) // Ankyrin repeats (many copies) (Ank_4) // Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTCGTCGGGACGCCTCATCTGGAGGGGGGATAGTTGTAGTGCCGTGTT |
Internal bar code: | AAGTTTAGAGCTAAGGTTTGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4097 |
LEAP-Seq percent confirming: | 87.3786 |
LEAP-Seq n confirming: | 90 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 103 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTCGCTCATAAAGTTGCCG |
Suggested primer 2: | CTATGCCGTAAGAGCCCTGG |