Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.016279 |
Chromosome: | chromosome 13 |
Location: | 1370390 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g571700 | CDPK9 | (1 of 1) PF00069//PF07714//PF13499 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) // EF-hand domain pair (EF-hand_7); Calcium/calmodulin-dependent protein kinase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGATTCCGGTTGCAGAGCGCTGACCACGGCAATTCGGGTACGGCCTGTG |
Internal bar code: | ACGCGGTACTAATCGCTACCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4148 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 52 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACGCTCAACTTTCCACGCT |
Suggested primer 2: | GTCTCCACGAAGCCAGTTCA |