Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.016316 |
Chromosome: | chromosome 7 |
Location: | 1406848 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g323100 | STK7,STPK7 | (1 of 1) K08853 - AP2-associated kinase [EC:2.7.11.1] (AAK); Serine/threonine protein kinase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTCACCCACCGTCATCCCTTCCTCCCTGCCATACCTCCCTGCCCCTCC |
Internal bar code: | GGCCTCTTGTTCTGATGTACCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 186 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 1 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTGTGCCGGAGAATGTGAGA |
Suggested primer 2: | TCGCTCCTAGGACAAGCTCT |