| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.016342 |
| Chromosome: | chromosome 10 |
| Location: | 1554780 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g428900 | RRM9,CGL72 | (1 of 1) 2.1.1.226 - 23S rRNA (cytidine(1920)-2'-O)-methyltransferase; Conserved in the Green Lineage | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTCCAGGCACGCCTTAGCCCTGTTGGCTCTGTACAAGTTGCCATGCTC |
| Internal bar code: | CCCACTTCATTCACCGCCGGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1488 |
| LEAP-Seq percent confirming: | 73.6842 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGTCACCACTTTGTCCGCC |
| Suggested primer 2: | TGTGCACGATGGAACGAGAA |