| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.016350 |
| Chromosome: | chromosome 3 |
| Location: | 8517119 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g211521 | FAP165 | (1 of 1) IPR006015//IPR006016//IPR014729 - Universal stress protein A // UspA // Rossmann-like alpha/beta/alpha sandwich fold; Flagellar Associated Protein 165 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTCGAATAAAGCCACACGGGTGCCCTCCTCACGTGGAGGCAGAGGGGC |
| Internal bar code: | ATTGTCTCCGGGCAGTCCTAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1426 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGTCTTGTGCTGTTGTGC |
| Suggested primer 2: | CACACGTTGCGCAACAGTTA |