Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.016546 |
Chromosome: | chromosome 10 |
Location: | 2760679 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g438200 | (1 of 2) IPR001841//IPR001876//IPR016024 - Zinc finger, RING-type // Zinc finger, RanBP2-type // Armadillo-type fold | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAACGAAGTGACCATGGCCGCCATCGAGGACGACGTGTGCGGCCGGCGC |
Internal bar code: | TGAGGAGTGTTTGTTTATCGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1879 |
LEAP-Seq percent confirming: | 94.7368 |
LEAP-Seq n confirming: | 18 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATGATCTGCGGCGTGATGAT |
Suggested primer 2: | CTCCTCCTCTCCCCTCTTCC |