Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.016560 |
Chromosome: | chromosome 16 |
Location: | 4190530 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g670200 | Microtubule-associated protein cysteine-rich PDZ-binding protein; (1 of 2) PTHR11805:SF1 - CYSTEINE-RICH PDZ-BINDING PROTEIN | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGACGCCTGCAGCGGCGTACGGAGCAAAGACATGGCGTCTCGCAAGCTC |
Internal bar code: | AGGACTAGTCTGCGTTAGTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2908 |
LEAP-Seq percent confirming: | 98.5916 |
LEAP-Seq n confirming: | 70 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 71 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTCATGCTAGCCATACCA |
Suggested primer 2: | CAAATAGTTCTGGGCCGGGT |