| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.016649 |
| Chromosome: | chromosome 7 |
| Location: | 5945741 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g354400 | CYP743B1,CYP21,CYP743B2,CYP743B3 | (1 of 3) 1.14.14.1//5.3.99.5 - Unspecific monooxygenase / Xenobiotic monooxygenase // Thromboxane-A synthase / Thromboxane synthetase; Cytochrome P450, CYP197 superfamily | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACGGCGTGGGGGCTGCTGCTACCAGCGGCCGCGGCGGGCTGTCGGGTGT |
| Internal bar code: | CGTAATATTTTGGATCAATTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1095 |
| LEAP-Seq percent confirming: | 75.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAACCGAACGTCAAAGCG |
| Suggested primer 2: | GTGCAGGGGACATGTAAGCT |