| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.017003 |
| Chromosome: | chromosome 7 |
| Location: | 4979826 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g347050 | RSP7 | (1 of 1) PF02197//PF13499//PF13833 - Regulatory subunit of type II PKA R-subunit (RIIa) // EF-hand domain pair (EF-hand_7) // EF-hand domain pair (EF-hand_8); Radial Spoke Protein 7 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATCTGGTGTTGGACGACCCGTCGCGGCAGACCTCCCCCTCCCTCCGCCT |
| Internal bar code: | AGCTTTTTATGATGGGGATTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 175 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCAGGTCAAGTCCATCTT |
| Suggested primer 2: | ACAAATCGTAGCAAGGCGGA |