| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.017082 |
| Chromosome: | chromosome 3 |
| Location: | 4607744 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g176700 | mS29,MRPS29,CPL4 | Mitochondrial ribosomal protein S29; (1 of 1) K17408 - small subunit ribosomal protein S29 (DAP3, MRPS29) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCCGCAACCGCAGCATCCCCGATGCTCTCATTACGCCGGCCGCCCTCC |
| Internal bar code: | GCCAGGGGGTTTAGTCGTTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1558 |
| LEAP-Seq percent confirming: | 88.8889 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGCTACACCCGCTGATAG |
| Suggested primer 2: | GTGTGGGACTTGAAGGACGT |