Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.017209 |
Chromosome: | chromosome 3 |
Location: | 5563093 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g185350 | BGS3,CALS1,GTR9,GTR15 | Callose synthase 1; (1 of 2) K11000 - callose synthase [EC:2.4.1.-] Glc b1-3 Glc (CALS) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCAACTAGCTCGGCGGCTGTGCCGGCGTCACGCGCCTTGCCGCCCTTG |
Internal bar code: | AAATGTCCATCGATTGCGCTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4822 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 49 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 49 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGGTGGACACGCAGATCTT |
Suggested primer 2: | CACCACCAAGACGTCATCCA |