| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.017386 |
| Chromosome: | chromosome 16 |
| Location: | 4707528 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g667100 | LMR3 | (1 of 1) PTHR20932//PTHR20932:SF9 - LOC443603 PROTEIN-RELATED // SUBFAMILY NOT NAMED; Predicted protein with LysM domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCAGCTAAGACGGCAGCGGCAGCTGCAGCTGGGCCAAACTCACGTCCA |
| Internal bar code: | AAATAGCACTCTTGTCTTCGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2373 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 56 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCACGTTTTGGCCCAAGTC |
| Suggested primer 2: | CACGGTCCTACGGATGGATG |