| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.017392 |
| Chromosome: | chromosome 1 |
| Location: | 7625361 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g053450 | CYA1 | (1 of 1) PTHR16305:SF26 - HYBRID SIGNAL TRANSDUCTION HISTIDINE KINASE G; Nucleotidyl cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCCGCCTGCGCCCCGTTCCTGCCGCTCCCACTCACCCAGGCAGCACG |
| Internal bar code: | AGGTAGGCCCCCGGAAATGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1300 |
| LEAP-Seq percent confirming: | 93.3333 |
| LEAP-Seq n confirming: | 28 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGGGGAGAGGTCTGGAACG |
| Suggested primer 2: | TTGAAGAACTTGCACACGCG |