| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.017548 |
| Chromosome: | chromosome 9 |
| Location: | 6452840 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g415050 | 3'UTR | ||
| Cre09.g415100 | ELG25,ELG33 | Exostosin-like glycosyltransferase; (1 of 2) PTHR11062//PTHR11062:SF89 - EXOSTOSIN HEPARAN SULFATE GLYCOSYLTRANSFERASE -RELATED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTTATCCATCAGGCCTCTCATCAGTCTCACCGCTTACCGAGTTTGCAA |
| Internal bar code: | GTGTATTAACGTCCCAACAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2809 |
| LEAP-Seq percent confirming: | 51.1905 |
| LEAP-Seq n confirming: | 43 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 84 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAGAAGCAGAAGGTGTGC |
| Suggested primer 2: | AGCCGTAATCCTCATCGCAG |