Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.017555 |
Chromosome: | chromosome 7 |
Location: | 811926 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g318250 | HLM12 | (1 of 2) IPR001214//IPR019734 - SET domain // Tetratricopeptide repeat; Histone-lysine N-methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCCATTGTGGCAAACAAGCCCCGGCCCCTCCAGGCAAGCTCCTTGCGT |
Internal bar code: | TAGAGCGCCTATTTGCATTGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4150 |
LEAP-Seq percent confirming: | 98.6842 |
LEAP-Seq n confirming: | 75 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 76 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGAGCAGAAGGGAATTCGGT |
Suggested primer 2: | TCCAATGCACTCACCAGGAC |