Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.017607 |
Chromosome: | chromosome 6 |
Location: | 7014096 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g297150 | RWP9 | (1 of 16) PF02042 - RWP-RK domain (RWP-RK); RWP-RK transcription factor | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCCGCCGCCACCGAACCCGAGCGTGTCTACGTCGTGTGGGGAGCCCGG |
Internal bar code: | TCGAGCTAGGCGCGCTAAAACT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2919 |
LEAP-Seq percent confirming: | 95.2381 |
LEAP-Seq n confirming: | 40 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTAGGGTTCGCATTCGACGA |
Suggested primer 2: | GCTTGGTTGCAAGGTTGAGG |