Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.017683 |
Chromosome: | chromosome 10 |
Location: | 1740098 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g430250 | ELG21 | Exostosin-like glycosyltransferase 21; (1 of 2) IPR000742//IPR004263//IPR013111 - EGF-like domain // Exostosin-like // EGF-like domain, extracellular | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTCGTATGGGCGAGATTGCAATTGGGTTGGGGGTCGTGAGGCCGCATG |
Internal bar code: | TAGTGAAGGCCATGGGGTAGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5552 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 88 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 88 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACGTGTGGCATTCTGGTCC |
Suggested primer 2: | TGTGCAGCTTGGGAATCCAT |