| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.017700 |
| Chromosome: | chromosome 11 |
| Location: | 1972500 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467774 | (1 of 1) IPR000104//IPR003409 - Antifreeze protein, type I // MORN motif | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAAAGCCGAGACGGAATCATGCGTCACCCCTCCACCGCGGCGCCGCCG |
| Internal bar code: | ATTAGCCAGTGTTGCTGTGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1173 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTAAAGTGGCCAGTGACGT |
| Suggested primer 2: | CCTTGTTGGCCGTCTCTCTT |