| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.017710 |
| Chromosome: | chromosome 1 |
| Location: | 5730919 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g041050 | AOC6 | Cationic amino acid transporter; (1 of 2) K03294 - basic amino acid/polyamine antiporter, APA family (TC.APA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGCCCAACGCCTCTAGCTGTGACCGGATGTCCGAAGCGTCAAATCCTC |
| Internal bar code: | GACTTCGTGGACGGTATAGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 760 |
| LEAP-Seq percent confirming: | 71.1111 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCTCTTTCGCACTGAGTT |
| Suggested primer 2: | CTATCTGCGTGTCCGAGCAT |