Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.017719 |
Chromosome: | chromosome 6 |
Location: | 6357800 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g293150 | PGM12 | (1 of 2) PTHR23029:SF12 - PHOSPHOMUTASE PMU1-RELATED; Phosphoglycerate mutase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGAAATTTCGGCCAAAACGCGCGGGATCTTGGGGGTTTTTTCGGCAAA |
Internal bar code: | TAAAGCTTGTGACGCTATGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4935 |
LEAP-Seq percent confirming: | 81.0127 |
LEAP-Seq n confirming: | 64 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 79 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGCTCCACACGCAACAAAG |
Suggested primer 2: | CAGGCATGACACCACTTTGC |