| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.017838 |
| Chromosome: | chromosome 3 |
| Location: | 3212185 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g165215 | ATG7 | (1 of 1) 2.7.7.49//2.7.7.7//2.7.7.80//3.1.26.4 - RNA-directed DNA polymerase / Revertase // DNA-directed DNA polymerase / DNA-dependent DNA polymerase // Molybdopterin-synthase adenylyltransferase // Ribonuclease H / RNase H; E1 activating enzyme for ATG8 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGTGATGCTGCGCTGGTGGTGCCGCTGGTGGTGGTGCCGCTGGTGGTTG |
| Internal bar code: | GCTTTCAATAATACAGGTTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 289 |
| LEAP-Seq percent confirming: | 11.1111 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGACAGGGGAAGGGAAAAGG |
| Suggested primer 2: | CCGTCATCCACCACACAAGA |