| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.017848 |
| Chromosome: | chromosome 3 |
| Location: | 6548045 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g194250 | (1 of 1) K05609 - ubiquitin carboxyl-terminal hydrolase L3 [EC:3.4.19.12] (UCHL3, YUH1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAATCACGGTATGAGTGACAACAACCCCACCGGCCCGGCACGCAGCTGC |
| Internal bar code: | ATATCTGTCAAGAATGCGTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 202 |
| LEAP-Seq percent confirming: | 17.3913 |
| LEAP-Seq n confirming: | 4 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGTGAGGGGCAATACACCG |
| Suggested primer 2: | TGGACTGTACACGCTCACAC |