| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.017890 |
| Chromosome: | chromosome 2 |
| Location: | 590980 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g077250 | EEP | (1 of 90) PF03372 - Endonuclease/Exonuclease/phosphatase family (Exo_endo_phos); Endonuclease/Exonuclease/phosphatase family protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAACACCTCCTGCAGCGCCACCACCACCGCGCAGCCGCCGCCCTCCGCC |
| Internal bar code: | CATTTAGCAGCCTTGGCGGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2015 |
| LEAP-Seq percent confirming: | 76.9231 |
| LEAP-Seq n confirming: | 30 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGGGTTGGCTCAACACTT |
| Suggested primer 2: | CATAATCTCCCACCCTCCGC |