| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.017994 |
| Chromosome: | chromosome 10 |
| Location: | 5214193 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g455950 | FAP407 | Flagellar Associated Protein 407; (1 of 4) K03809 - NAD(P)H dehydrogenase (quinone) (wrbA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTGACGCGCGAAGCCTCAGAGCCGGTAGCCCGGTACCCGTGCTGCCGC |
| Internal bar code: | GGTTATTAGAGTAGGGCGTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 161 |
| LEAP-Seq percent confirming: | 23.0769 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 30 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGCACGAAAAAGCTCAACG |
| Suggested primer 2: | GGATCCAAAGCTCTGTGGCT |