| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.018017 |
| Chromosome: | chromosome 1 |
| Location: | 6754065 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g048200 | (1 of 1) PTHR10887//PTHR10887:SF140 - DNA2/NAM7 HELICASE FAMILY // PROTEIN ERI-7 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATTGCGGGTTAATGTGTAGTACGGTATGCACCGTCGCCGAAGACTTCCA |
| Internal bar code: | GGAGCCACGCTACTAATTAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1624 |
| LEAP-Seq percent confirming: | 84.2105 |
| LEAP-Seq n confirming: | 16 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACTCCCCCAACCTCATC |
| Suggested primer 2: | ACCTTTACGCTTCTTGCCGA |