Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.018047 |
Chromosome: | chromosome 2 |
Location: | 7597401 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g386912 | DGTT2 | Diacylglycerol acyltransferase, DGAT Type 2; (1 of 4) K14457 - 2-acylglycerol O-acyltransferase 2 (MOGAT2, MGAT2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTGACTGCCCCACCCGCCGCCCACCGCTACCGCCTACCTTCCAAAACC |
Internal bar code: | AATTGTAATTATGGCGTAAGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1272 |
LEAP-Seq percent confirming: | 66.6667 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCAGCCAAGCTCCAGTTACA |
Suggested primer 2: | GCGTGCTAGTAGCCAGTGAA |