Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.018085 |
Chromosome: | chromosome 6 |
Location: | 2549587 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g800642 | (1 of 1) PF05066//PF10537//PF15613//PF15614 - HB1, ASXL, restriction endonuclease HTH domain (HARE-HTH) // ATP-utilising chromatin assembly and remodelling N-terminal (WAC_Acf1_DNA_bd) // WSTF, HB1, Itc1p, MBD9 motif 2 (WHIM2) // WSTF, HB1, Itc1p, MBD9 motif 3 (WHIM3) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCTGCTGGTAGGCCTCCGCCTCCGCAAGCCGCCCGCGCGCGGCCGCC |
Internal bar code: | CCATTTGGAACGTTATATTTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 352 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGCCGGGGGAAATGGAAAT |
Suggested primer 2: | TGCCTACCGTCAACCACTTC |