| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.018108 |
| Chromosome: | chromosome 12 |
| Location: | 5867509 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g533400 | (1 of 1) PTHR13527:SF0 - SAYSVFN DOMAIN-CONTAINING PROTEIN 1 | intron | |
| lncRNA_TCONS_00110219 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGACTCTCGGCCTCGCCGCCCGCTGTTGCCAACCACGCGGCCTCCCAT |
| Internal bar code: | GTGGATGTAATTGTTTTGCTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1073 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCAGTACGGTGTGAAGGA |
| Suggested primer 2: | CCTCTCGTGCTCGGCATTAT |