| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.018118 |
| Chromosome: | chromosome 9 |
| Location: | 450931 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g800980 | (1 of 4) 1.1.1.3 - Homoserine dehydrogenase | intron | |
| Cre18.g749347 | (1 of 1) PTHR14580//PTHR14580:SF0 - UNCHARACTERIZED // MULTIPLE MYELOMA TUMOR-ASSOCIATED PROTEIN 2 | 3'UTR_intron | |
| Cre18.g749397 | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTACCGCCTCCTGCTCCGCCTCGCGGATACGTGGGTGTGGTGGACGCC |
| Internal bar code: | CTTCCAACGCGGTCTCACCCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2026 |
| LEAP-Seq percent confirming: | 54.386 |
| LEAP-Seq n confirming: | 31 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTCGATGGGCTCACTACG |
| Suggested primer 2: | GGCAATCCCTCCTCCTCAAC |