| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.018178 |
| Chromosome: | chromosome 2 |
| Location: | 309379 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g075050 | PTA1 | (1 of 10) IPR005828//IPR020846 - Major facilitator, sugar transporter-like // Major facilitator superfamily domain; Proton/phosphate symporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATCACAGGTGCAGATGCGCGCCCGCACTGTAGGTGTGCACTAGCACGCG |
| Internal bar code: | AGCTTGAGACTTTGCTACGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2645 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 47 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGTTACGACATTGCATCC |
| Suggested primer 2: | TTGCTTGCACACACATGTCG |