| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.018274 |
| Chromosome: | chromosome 16 |
| Location: | 4968685 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g686400 | FAO13 | FAD-dependent oxidoreductase; (1 of 1) PTHR10742//PTHR10742:SF307 - AMINE OXIDASE // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCGCTTCGAGCCGCTGTTCGTGTTCATCCCCATTGACCGGGTGGGTGG |
| Internal bar code: | GAAGTACGCTACTGCACAACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 418 |
| LEAP-Seq percent confirming: | 22.2222 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACCCTACCACCCAATCCC |
| Suggested primer 2: | CATCCCAACCATCCCAACCA |