| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.018279 |
| Chromosome: | chromosome 1 |
| Location: | 4230264 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g028600 | SDR2 | (1 of 1) IPR002347//IPR003560//IPR013968 - Glucose/ribitol dehydrogenase // 2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase // Polyketide synthase, ketoreductase domain; Short-chain dehydrogenase/reductase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAGAACATCCGCGTCAACTGCGTGGCGCCCGGCCTCACACGCACGCCC |
| Internal bar code: | TACGGAGTATTAATACAGACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1168 |
| LEAP-Seq percent confirming: | 95.4545 |
| LEAP-Seq n confirming: | 21 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTCGCCATGTACATGTGT |
| Suggested primer 2: | GGAGACCTACGGCAAGATCG |