Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.018281 |
Chromosome: | chromosome 8 |
Location: | 4046393 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g382750 | (1 of 7) IPR000104//IPR020683 - Antifreeze protein, type I // Ankyrin repeat-containing domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGGAGCTAGTAGGTTGTGGAGCTGCTATCTAACACAGGATAGGCCGGC |
Internal bar code: | TTTATGATTTCTTAAGCGGTGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2656 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 36 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCGCGCTCATGTTTGCTAC |
Suggested primer 2: | GGGTTCGTCGGCTTCATGG |