Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | - |
Strain: | CLIP2.018287 |
Chromosome: | chromosome 10 |
Location: | 5222083 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g456050 | AGG6 | (1 of 4) K03809 - NAD(P)H dehydrogenase (quinone) (wrbA); Aggregation 6 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACCACTCCAGGTGGCCGAGACGCTGCCCGCCGAGGTTCTGGAGAAGA |
Internal bar code: | AGCTGCACATACCTTGCGCAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1782 |
LEAP-Seq percent confirming: | 96.2963 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTTGCAGTTGTCACGCATG |
Suggested primer 2: | ACGGCCATCCTAAGACCTCT |