| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.018315 |
| Chromosome: | chromosome 12 |
| Location: | 5222206 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g527300 | RFC5 | DNA replication factor C complex subunit 5; (1 of 1) PTHR11669//PTHR11669:SF9 - REPLICATION FACTOR C / DNA POLYMERASE III GAMMA-TAU SUBUNIT // REPLICATION FACTOR C SUBUNIT 5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATTCCGTGTGGGCAGTGTCTGTTGTGTGTGTGGAGCTGGGTGATCTTG |
| Internal bar code: | GGCCACAAGTGAGCGTCACTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1015 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACCTTAAAGCGCCGCAAG |
| Suggested primer 2: | CAGGCGCTATAGGAGTTGGG |