| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.018321 |
| Chromosome: | chromosome 17 |
| Location: | 148467 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g696900 | STK20,STPK20 | (1 of 2) IPR000719//IPR001229//IPR001245//IPR002290//IPR011009//IPR016187//IPR020635 - Protein kinase domain // Jacalin-like lectin domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // C-type lectin fold // Tyrosine-protein kinase, catalytic domain; Serine/threonine protein kinase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACATAGTCAGGATCCGAGTGGAACCACATGACAGCTGCGCGCATAGGT |
| Internal bar code: | AAGAACACTTTCCGATAAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4418 |
| LEAP-Seq percent confirming: | 76.7442 |
| LEAP-Seq n confirming: | 66 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 86 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAATACATACCGACCGGCGT |
| Suggested primer 2: | CTGTCTGGCTTACTGCTGCT |