| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.018326 |
| Chromosome: | chromosome 6 |
| Location: | 7286634 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g299150 | PHC9,PHC26 | (1 of 24) IPR003882//IPR024616 - Pistil-specific extensin-like protein // Pherophorin; Pherophorin-chlamydomonas homolog 26 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAGCCAGGCAAACCTACCCCACCATGTCCCCACCTCTGCCGTACAGCT |
| Internal bar code: | AGGAGTCATAGCTTGGTTCCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3174 |
| LEAP-Seq percent confirming: | 98.9011 |
| LEAP-Seq n confirming: | 90 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 91 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCAAGACAGTGCCTCAGA |
| Suggested primer 2: | CTATCGTCGCTGTCCCAGTC |