| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.018331 |
| Chromosome: | chromosome 9 |
| Location: | 6350063 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g414350 | (1 of 3) PF04824//PF04825 - Conserved region of Rad21 / Rec8 like protein (Rad21_Rec8) // N terminus of Rad21 / Rec8 like protein (Rad21_Rec8_N) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCTGCAGGTGCGACCGTGCAAGGTTGTCTTTTGCCGCTATCCTTAAGG |
| Internal bar code: | TCCTGAGAAAACTGATAGAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1365 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 45 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTATCCAGTCCACCCCTCC |
| Suggested primer 2: | GAGGGAGAGGAGGAGCTTGA |