Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.018355 |
Chromosome: | chromosome 14 |
Location: | 1751983 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g619166 | CSK6 | Casein kinase II-related Ser/Thr kinase, alpha chain; (1 of 3) K03097 - casein kinase II subunit alpha (CSNK2A) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGAAATAAATGAAGAGTAAAGGCCAAAGTGAAAGCCAAAGTTGGAGTG |
Internal bar code: | CAACGATACGGACAGGATCGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2989 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 19 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACTCGTACACAGCTCAGCA |
Suggested primer 2: | CACCTCCCTGAATGAACCCC |