| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.018405 |
| Chromosome: | chromosome 14 |
| Location: | 206532 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g608970 | bL34m,MRPL34,RPL34B | (1 of 4) 1.4.3.3 - D-amino-acid oxidase; Mitochondrial ribosomal protein L34 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGGCGCAGAGGGTGCTGGCGATCTGCGGTGAAGCCGCTGGCATGCAG |
| Internal bar code: | TTAGTTGAAGGTTATACCCGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2497 |
| LEAP-Seq percent confirming: | 98.4127 |
| LEAP-Seq n confirming: | 62 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGCATGCATAACTGAACCCG |
| Suggested primer 2: | CCCCCTCATACACACACACC |