| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | - |
| Strain: | CLIP2.018424 |
| Chromosome: | chromosome 17 |
| Location: | 3298190 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g722250 | RRM14 | Putative rRNA (guanine-N2-)-methyltransferase; (1 of 1) 2.1.1.173//2.1.1.264 - 23S rRNA (guanine(2445)-N(2))-methyltransferase // 23S rRNA (guanine(2069)-N(7))-methyltransferase / 23S rRNA m(7)G(2069) methyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCAGGAGGAGCAGGAGCAGGGGGCGCCCAGGCGAGTGCTCACGCCCCG |
| Internal bar code: | AATATGTTTCTGTCGGACCACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4185 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGGTGACGGTCATGGACA |
| Suggested primer 2: | CCCGTCAGAAGTCAGCACTT |