| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.018438 |
| Chromosome: | chromosome 4 |
| Location: | 46392 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g214097 | (1 of 1) 3.2.1.162 - Lambda-carrageenase / Endo-beta-1,4-carrageenose 2,6,2'-trisulfate-hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGGATGGCTGTCTCCCCCCCTCCCGCCTGTACCTCCCTGCCTGCGTGGG |
| Internal bar code: | TTAAGCGGGCGGCGAGACTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 285 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGAACTGAGTGCGACTGG |
| Suggested primer 2: | TTTCTCCAACGCCCAGGATC |