| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.018475 |
| Chromosome: | chromosome 10 |
| Location: | 5257251 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g456350 | KIN7-2,KIN7B | Kinesin motor protein; (1 of 1) PF00225//PF11995 - Kinesin motor domain (Kinesin) // Domain of unknown function (DUF3490) (DUF3490) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTGGACCTAGCCGGCAGCGAGCGCCTCACGCAGGCGTCTATGACGGAC |
| Internal bar code: | TGTATGTACCACTACAGGATGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2347 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 34 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAGTCTGTTGATGCCCAT |
| Suggested primer 2: | CTCTATGACCGGGTCTTCGC |