Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.018562 |
Chromosome: | chromosome 12 |
Location: | 5902837 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g533600 | DESI6,DeSI-6 | (1 of 6) PF05903 - PPPDE putative peptidase domain (Peptidase_C97); DeSI-type SUMO protease | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAAGCCACGCACAATCTGGTGCGAGTGCACCCATGTGATTTGCGGCGT |
Internal bar code: | TTATGCAGCAGCCCGTTTTGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1842 |
LEAP-Seq percent confirming: | 88.8889 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGCTGCTTTGAGTGTACGT |
Suggested primer 2: | GAACTGTGGCCCTGAATGGA |