Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.018619 |
Chromosome: | chromosome 14 |
Location: | 795637 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g612700 | FAP50,DRC7 | Nexin-dynein regulatory complex 7; (1 of 1) PF13415//PF13418//PF13855 - Galactose oxidase, central domain (Kelch_3) // Galactose oxidase, central domain (Kelch_4) // Leucine rich repeat (LRR_8) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCGCGCGCTTCGGCGACTGCAGCCGCTGGGACGGCATGGTGGAGCGGC |
Internal bar code: | AACAAGGCGCGGCTCGCATCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 248 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAACAGTGGAGGTGAAGGGG |
Suggested primer 2: | CTCTCTAACACCGCCTGTCC |