| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.018683 |
| Chromosome: | chromosome 16 |
| Location: | 893277 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g648150 | (1 of 6) PTHR24114//PTHR24114:SF2 - FAMILY NOT NAMED // LEUCINE-RICH REPEAT-CONTAINING PROTEIN 74 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGCGGGCTTCGTTTTGTTGTTTTTAACACACAGACACACACACACACA |
| Internal bar code: | ACAACTGACCAATCGCTTACAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1468 |
| LEAP-Seq percent confirming: | 78.2609 |
| LEAP-Seq n confirming: | 54 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 69 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGTGTATGCGGCGACATG |
| Suggested primer 2: | GCTGGCTACCCATGCAACTA |